1. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

HBV DNA

" in MedChemExpress (MCE) Product Catalog:

45

Inhibitors & Agonists

3

Natural
Products

1

Isotope-Labeled Compounds

1

Click Chemistry

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-149357

    HBV Infection
    Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .
    Yhhu6669
  • HY-W676876

    HBV Infection
    Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
    Oxynitidine
  • HY-144319

    HBV Infection
    SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM) .
    SHR5133
  • HY-144047

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .
    HBV-IN-16
  • HY-144045

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .
    HBV-IN-14
  • HY-144046

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .
    HBV-IN-15
  • HY-N10404

    HBV Inflammation/Immunology
    Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits HBV DNA replication and significantly decreases the level of supernatant HBV RNA with EC50 values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .
    Junceellolide C
  • HY-145059

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM<EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15 .
    HBV-IN-12
  • HY-148781

    HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-148780

    HBV Infection
    HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .
    HBV-IN-29
  • HY-146395

    HBV DNA/RNA Synthesis Apoptosis Infection Cancer
    HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC50 of 0.58 μM. HBV-IN-23 inhibits HBV DNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .
    HBV-IN-23
  • HY-156702

    HBV Infection
    HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections .
    HBV-IN-38
  • HY-131343

    HBV DNA/RNA Synthesis Infection
    HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .
    HBV-IN-4
  • HY-148782

    HBV Infection
    HBV-IN-31 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-31 shows anti-HBV activity with an IC50 value of 0.13 µM for HBsAg. HBV-IN-31 inhibits cell growth .
    HBV-IN-31
  • HY-148783

    HBV Infection
    HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC50 value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth .
    HBV-IN-32
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-155547

    HBV Infection
    HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC50 of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively .
    HBV-IN-34
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-146011

    HBV DNA/RNA Synthesis Infection
    HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC50 of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (KD = 60.0 μM) .
    HBV-IN-21
  • HY-146394

    HBV DNA/RNA Synthesis Infection
    HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC50 values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .
    HBV-IN-22
  • HY-117650A
    RG7834
    4 Publications Verification

    RO 7020322

    HBV Infection
    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .
    RG7834
  • HY-147863

    HBV Infection Neurological Disease
    HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent HBV inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBV DNA, HBsAg, and HBeAg, with EC50 values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .
    HBV-IN-24
  • HY-145052

    HBV Infection
    HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells) . From patent WO2018001952A1, example 20.
    HBV-IN-9
  • HY-100028
    AT-130
    1 Publications Verification

    HBV DNA/RNA Synthesis Infection Cancer
    AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .
    AT-130
  • HY-157993

    HBV Infection
    SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
    SAG-524
  • HY-B1826
    Adefovir
    1 Publications Verification

    GS-0393; PMEA

    HBV Reverse Transcriptase Infection
    Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
    Adefovir
  • HY-126970

    HBV Infection
    HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis .
    HBF-0259
  • HY-B1826S2

    GS-0393-d4; PMEA-d4

    HBV Reverse Transcriptase Infection
    Adefovir-d4 is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].
    Adefovir-d4
  • HY-123767

    HBV Infection
    HEC72702 is a potent and orally active hepatitis B virus capsid inhibitor with an EC50 values of 0.039 µM. HEC72702 dose-dependently reduced HBV DNA in both the plasma and livers .
    HEC72702
  • HY-106235

    HBV DNA/RNA Synthesis Infection
    LB80317 is an active metabolite of LB80380 and suppresses the DNA synthesis of HBV with an EC50 of 0.5 μM. LB80317 has antiviral effect and has the potential for chronic hepatitis B treatment .
    LB80317
  • HY-148560B

    HBV Infection
    cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .
    cis-ccc_R08
  • HY-19447A

    LB80380 maleate

    HBV Infection
    Besifovir Dipivoxil maleate (LB80380 maleate) is an oral proagent of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies [2]
    Besifovir Dipivoxil maleate
  • HY-124614
    GLP-26
    1 Publications Verification

    HBV Infection
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    GLP-26
  • HY-101954

    ORI-9020; SB-9000

    HBV Infection
    Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses .
    Inarigivir
  • HY-148201

    HBV Infection
    Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .
    Oleana-2,12-dien-28-oic acid
  • HY-N3239

    NADPH Oxidase HBV
    Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of hepatitis B virus (HBV) DNA replication with IC50 of 3.99 μM .
    Mulberrofuran G
  • HY-13859

    L-FMAU

    HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
    Clevudine
  • HY-101954A

    ORI-9020 ammonium; SB-9000 ammonium

    HBV Infection Inflammation/Immunology
    Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .
    Inarigivir ammonium
  • HY-145060

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .
    HBV-IN-13
  • HY-145053

    HBV Infection
    HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    HBV-IN-10
  • HY-145053A

    HBV Infection
    (5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    (5S,8R)-HBV-IN-10
  • HY-116364

    3'-Azido-3'-deoxythymidine-5'-triphosphate

    HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis Infection
    AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate also inhibits the DNA polymerase of HBV. AZT triphosphate activates the mitochondria-mediated apoptosis pathway .
    AZT triphosphate
  • HY-109195
    Vebicorvir
    1 Publications Verification

    ABI-H0731

    HBV Infection Inflammation/Immunology
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
    Vebicorvir
  • HY-116364A

    3'-Azido-3'-deoxythymidine-5'-triphosphate TEA

    HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis Infection
    AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) TEA is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate TEA exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate TEA also inhibits the DNA polymerase of HBV. AZT triphosphate TEA activates the mitochondria-mediated apoptosis pathway .
    AZT triphosphate TEA
  • HY-116364B

    3'-Azido-3'-deoxythymidine-5'-triphosphate tetraammonium

    HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis Infection
    AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis pathway .
    AZT triphosphate tetraammonium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: